Stem-loop sequence hsa-mir-7151

AccessionMI0023611 (change log)
Symbol HGNC:MIR7151
DescriptionHomo sapiens miR-7151 stem-loop
Stem-loop
   -  -     cu u       uu     ggau 
5'  ga uccau  c gccugua  ggcuu    u
    || |||||  | |||||||  |||||     
3'  cu gggua  g cggacau  ccgaa    c
   a  c     ag u       --     acgu 
Get sequence
Deep sequencing
65 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 67403351-67403410 [-]
antisense
OTTHUMT00000462412 ; RP11-222A11.1-015; intron 1
OTTHUMT00000462413 ; RP11-222A11.1-013; intron 1
OTTHUMT00000461412 ; RP11-222A11.1-009; intron 1
OTTHUMT00000461413 ; RP11-222A11.1-010; intron 1
OTTHUMT00000461416 ; RP11-222A11.1-005; intron 1
OTTHUMT00000462414 ; RP11-222A11.1-014; intron 1
OTTHUMT00000048275 ; RP11-222A11.1-001; intron 6
ENST00000595269 ; RP11-222A11.1-015; intron 1
ENST00000598092 ; RP11-222A11.1-013; intron 1
ENST00000601926 ; RP11-222A11.1-009; intron 1
ENST00000601888 ; RP11-222A11.1-010; intron 1
ENST00000594054 ; RP11-222A11.1-005; intron 1
ENST00000600848 ; RP11-222A11.1-014; intron 1
ENST00000433152 ; RP11-222A11.1-001; intron 6
Database links

Mature sequence hsa-miR-7151-5p

Accession MIMAT0028212
Sequence

1 - 

gauccaucucugccuguauuggc

 - 23

Get sequence
Deep sequencing53 reads, 13 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-7151-3p

Accession MIMAT0028213
Sequence

40 - 

cuacaggcuggaaugggcuca

 - 60

Get sequence
Deep sequencing12 reads, 10 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).