Stem-loop sequence hsa-mir-7114

AccessionMI0022965 (change log)
Symbol HGNC:MIR7114
DescriptionHomo sapiens miR-7114 stem-loop
Literature search

1 open access papers mention hsa-mir-7114
(3 sentences)

Stem-loop
   uccgcucu      u      ccu   -   ug 
5'         guggag ggggug   guc ccc  c
           |||||| ||||||   ||| |||  c
3'         caccuc ccccac   cag ggg  a
   -----gac      u      --c   u   uc 
Get sequence
Deep sequencing
90 reads, 0 reads per million, 47 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 137450026-137450086 [-]
intergenic
Database links

Mature sequence hsa-miR-7114-5p

Accession MIMAT0028125
Sequence

6 - 

ucuguggaguggggugccugu

 - 26

Get sequence
Deep sequencing53 reads, 35 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-7114-3p

Accession MIMAT0028126
Sequence

41 - 

ugacccaccccucuccaccag

 - 61

Get sequence
Deep sequencing37 reads, 20 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).