Stem-loop sequence hsa-mir-7113

AccessionMI0022964 (change log)
Symbol HGNC:MIR7113
DescriptionHomo sapiens miR-7113 stem-loop
Stem-loop
     c       aca   u  ---      ucu 
5' cu cagggag   gug gu   gaggcc   u
   || |||||||   ||| ||   ||||||   g
3' ga gucucuc   cgc cg   cuccgg   c
     c       ---   c  ucc      uac 
Get sequence
Deep sequencing
162 reads, 0 reads per million, 70 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 68032864-68032922 [+]
antisense
OTTHUMT00000394750 ; C11orf24-001; intron 2
OTTHUMT00000394752 ; C11orf24-002; intron 2
OTTHUMT00000394753 ; C11orf24-007; intron 2
OTTHUMT00000394754 ; C11orf24-006; intron 2
ENST00000304271 ; C11orf24-001; intron 2
ENST00000533310 ; C11orf24-002; intron 2
ENST00000530166 ; C11orf24-007; intron 2
ENST00000527280 ; C11orf24-006; intron 2
Clustered miRNAs
< 10kb from hsa-mir-7113
hsa-mir-7113chr11: 68032864-68032922 [+]
hsa-mir-4691chr11: 68033897-68033981 [+]
Database links

Mature sequence hsa-miR-7113-5p

Accession MIMAT0028123
Sequence

2 - 

uccagggagacagugugugag

 - 22

Get sequence
Deep sequencing120 reads, 49 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-7113-3p

Accession MIMAT0028124
Sequence

37 - 

ccucccugcccgccucucugcag

 - 59

Get sequence
Deep sequencing25 reads, 18 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).