Stem-loop sequence hsa-mir-7112

AccessionMI0022963 (change log)
Previous IDshsa-mir-7112-1
Symbol HGNC:MIR7112
DescriptionHomo sapiens miR-7112 stem-loop
Stem-loop
   acgggcagggcagugcacccugcag    ga     a 
5'                          guga  gcggg a
                            ||||  |||||  
3'                          cacu  cgucc c
   ----------gaucccgguuuccga    -a     a 
Get sequence
Deep sequencing
126 reads, 0 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 144262673-144262737 [-]
intergenic
Database links

Mature sequence hsa-miR-7112-5p

Accession MIMAT0028121
Sequence

1 - 

acgggcagggcagugcacccug

 - 22

Get sequence
Deep sequencing25 reads, 10 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-7112-3p

Accession MIMAT0028122
Sequence

43 - 

ugcaucacagccuuuggcccuag

 - 65

Get sequence
Deep sequencing94 reads, 20 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).