Stem-loop sequence hsa-mir-7110

AccessionMI0022961 (change log)
Symbol HGNC:MIR7110
DescriptionHomo sapiens miR-7110 stem-loop
Stem-loop
   ggg  u     u     -         ugcacagccagcucag 
5'    gc ggggg guggg gagagagag                g
      || ||||| ||||| |||||||||                g
3'    cg ucccu caccc cucucucuc                a
   -ga  -     u     u         ucucuuucucgaaauu 
Get sequence
Deep sequencing
10985 reads, 578 reads per million, 158 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 123161794-123161879 [+]
antisense
OTTHUMT00000355889 ; ADCY5-001; intron 1
ENST00000462833 ; ADCY5-001; intron 1
Database links

Mature sequence hsa-miR-7110-5p

Accession MIMAT0028117
Sequence

6 - 

uggggguguggggagagagag

 - 26

Get sequence
Deep sequencing27 reads, 19 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-7110-3p

Accession MIMAT0028118
Sequence

65 - 

ucucucucccacuucccugcag

 - 86

Get sequence
Deep sequencing3390 reads, 142 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).