Stem-loop sequence hsa-mir-711

AccessionMI0012488 (change log)
Symbol HGNC:MIR711
DescriptionHomo sapiens miR-711 stem-loop
Gene family MIPF0000748; mir-711
Literature search

6 open access papers mention hsa-mir-711
(180 sentences)

Stem-loop
   -------a  g    uga         ca    g  g   gc 
5'         cu acuu   gucucuccu  gggu cu cag  a
           || ||||   |||||||||  |||| || |||   
3'         ga ugaa   cagagaggg  ccca gg guc  a
   guagaggg  g    -ug         -a    -  g   ga 
Get sequence
Deep sequencing
17 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 48578902-48578977 [-]
sense
OTTHUMT00000344788 ; PFKFB4-008; intron 3
OTTHUMT00000344791 ; PFKFB4-011; intron 3
OTTHUMT00000257503 ; PFKFB4-001; intron 4
OTTHUMT00000344754 ; PFKFB4-002; intron 4
OTTHUMT00000344757 ; PFKFB4-005; intron 4
OTTHUMT00000344789 ; PFKFB4-009; intron 4
OTTHUMT00000344790 ; PFKFB4-010; intron 4
OTTHUMT00000344755 ; PFKFB4-003; intron 5
OTTHUMT00000344756 ; PFKFB4-004; intron 5
OTTHUMT00000344758 ; PFKFB4-006; intron 5
OTTHUMT00000344792 ; PFKFB4-012; intron 6
ENST00000468162 ; PFKFB4-008; intron 3
ENST00000471890 ; PFKFB4-011; intron 3
ENST00000545984 ; PFKFB4-203; intron 3
ENST00000232375 ; PFKFB4-001; intron 4
ENST00000416568 ; PFKFB4-002; intron 4
ENST00000383734 ; PFKFB4-005; intron 4
ENST00000452531 ; PFKFB4-009; intron 4
ENST00000412035 ; PFKFB4-010; intron 4
ENST00000536104 ; PFKFB4-201; intron 4
ENST00000417753 ; PFKFB4-003; intron 5
ENST00000445633 ; PFKFB4-004; intron 5
ENST00000490115 ; PFKFB4-006; intron 5
ENST00000541519 ; PFKFB4-202; intron 5
ENST00000496767 ; PFKFB4-012; intron 6
Database links

Mature sequence hsa-miR-711

Accession MIMAT0012734
Sequence

43 - 

gggacccagggagagacguaag

 - 64

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence by similarity; MI0004695
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).