Stem-loop sequence hsa-mir-7109

AccessionMI0022960 (change log)
Symbol HGNC:MIR7109
DescriptionHomo sapiens miR-7109 stem-loop
Stem-loop
   -gucuc     -   -      cc  -   -  c 
5'       cuggg ggg aggaga  cu gcu cu c
         ||||| ||| ||||||  || ||| ||  
3'       gaccu ccc uccucu  ga cga gg c
   cgauua     u   g      cc  a   c  u 
Get sequence
Deep sequencing
60 reads, 2.78 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 31621467-31621531 [-]
antisense
OTTHUMT00000321916 ; LIMK2-006; intron 1
OTTHUMT00000321912 ; LIMK2-002; intron 1
OTTHUMT00000321911 ; LIMK2-001; intron 1
ENST00000462625 ; LIMK2-006; intron 1
ENST00000406516 ; LIMK2-002; intron 1
ENST00000331728 ; LIMK2-001; intron 1
ENST00000444929 ; LIMK2-201; intron 1
Database links

Mature sequence hsa-miR-7109-5p

Accession MIMAT0028115
Sequence

6 - 

cuggggggaggagacccugcu

 - 26

Get sequence
Deep sequencing20 reads, 17 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-7109-3p

Accession MIMAT0028116
Sequence

38 - 

caagccucuccugcccuuccag

 - 59

Get sequence
Deep sequencing37 reads, 21 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).