Stem-loop sequence hsa-mir-7108

AccessionMI0022959 (change log)
Symbol HGNC:MIR7108
DescriptionHomo sapiens miR-7108 stem-loop
Stem-loop
   g     -cc   a       ------     -       cc        
5'  ugugg   ggc ggcgggu      gggcg ggggcgg  gguggga 
    |||||   ||| |||||||      ||||| |||||||  |||||| a
3'  acacc   cug ccgccca      cccgc ccccgcc  ccgcccc 
   g     ccu   c       cucacg     g       --        
Get sequence
Deep sequencing
4235 reads, 184 reads per million, 63 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 2434914-2435000 [-]
sense
OTTHUMT00000319207 ; LMNB2-003; exon 1
OTTHUMT00000384489 ; LMNB2-006; intron 2
OTTHUMT00000319205 ; LMNB2-001; intron 5
ENST00000490554 ; LMNB2-003; exon 1
ENST00000527409 ; LMNB2-006; intron 2
ENST00000325327 ; LMNB2-001; intron 5
ENST00000582871 ; LMNB2-201; intron 5
Database links

Mature sequence hsa-miR-7108-5p

Accession MIMAT0028113
Sequence

1 - 

guguggccggcaggcgggugg

 - 21

Get sequence
Deep sequencing55 reads, 24 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-7108-3p

Accession MIMAT0028114
Sequence

68 - 

acccgcccgucuccccacag

 - 87

Get sequence
Deep sequencing7 reads, 4 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).