Stem-loop sequence hsa-mir-7106

AccessionMI0022957 (change log)
Symbol HGNC:MIR7106
DescriptionHomo sapiens miR-7106 stem-loop
Literature search

1 open access papers mention hsa-mir-7106
(1 sentences)

Stem-loop
   gcuu      gga      cuu      gauccc 
5'     cuggga   ggggau   gggagu      a
       ||||||   ||||||   ||||||      a
3'     gacccu   ucccua   cccucg      c
   ----      --g      agu      agucga 
Get sequence
Deep sequencing
47 reads, 0 reads per million, 31 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 113159113-113159177 [-]
antisense
OTTHUMT00000405890 ; RPH3A-023; intron 1
OTTHUMT00000405774 ; RPH3A-013; intron 1
OTTHUMT00000405811 ; RPH3A-021; intron 1
OTTHUMT00000405893 ; RPH3A-022; intron 1
OTTHUMT00000405894 ; RPH3A-026; intron 2
OTTHUMT00000405777 ; RPH3A-015; intron 3
OTTHUMT00000405892 ; RPH3A-024; intron 3
OTTHUMT00000405776 ; RPH3A-014; intron 4
OTTHUMT00000405891 ; RPH3A-025; intron 4
ENST00000548197 ; RPH3A-023; intron 1
ENST00000543106 ; RPH3A-013; intron 1
ENST00000551593 ; RPH3A-021; intron 1
ENST00000547840 ; RPH3A-022; intron 1
ENST00000546703 ; RPH3A-026; intron 2
ENST00000549736 ; RPH3A-015; intron 3
ENST00000551748 ; RPH3A-024; intron 3
ENST00000547686 ; RPH3A-014; intron 4
ENST00000546426 ; RPH3A-025; intron 4
Database links

Mature sequence hsa-miR-7106-5p

Accession MIMAT0028109
Sequence

6 - 

ugggaggaggggaucuuggg

 - 25

Get sequence
Deep sequencing21 reads, 19 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-7106-3p

Accession MIMAT0028110
Sequence

43 - 

agcucccugaaucccugucccag

 - 65

Get sequence
Deep sequencing23 reads, 17 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).