Stem-loop sequence hsa-mir-6895

AccessionMI0022742 (change log)
Symbol HGNC:MIR6895
DescriptionHomo sapiens miR-6895 stem-loop
Literature search

1 open access papers mention hsa-mir-6895
(2 sentences)

Stem-loop
   ---ca   c     c   c    agua  ca     -a  a 
5'      gcu agggc agg acag    ag  ucaau  gc u
        ||| ||||| ||| ||||    ||  |||||  ||  
3'      cgg ucccg ucu uguc    uc  aguug  cg u
   gauuc   u     c   c    -gag  -a     aa  g 
Get sequence
Deep sequencing
63 reads, 4.35 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 53195411-53195488 [-]
antisense
OTTHUMT00000468381 ; RP11-258C19.5-005; intron 3
ENST00000604369 ; LINC01155-005; intron 3
Clustered miRNAs
< 10kb from hsa-mir-6895
hsa-mir-6894chrX: 53198889-53198945 [-]
hsa-mir-6895chrX: 53195411-53195488 [-]
Database links

Mature sequence hsa-miR-6895-5p

Accession MIMAT0027690
Sequence

6 - 

cagggccaggcacagaguaag

 - 26

Get sequence
Deep sequencing18 reads, 12 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6895-3p

Accession MIMAT0027691
Sequence

57 - 

ugucucucgcccuuggccuuag

 - 78

Get sequence
Deep sequencing38 reads, 10 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).