Stem-loop sequence hsa-mir-6894

AccessionMI0022741 (change log)
Symbol HGNC:MIR6894
DescriptionHomo sapiens miR-6894 stem-loop
Literature search

1 open access papers mention hsa-mir-6894
(3 sentences)

Stem-loop
   caagaa      u    a  u    c   c 
5'       ggagga ggag gc gggc aga a
         |||||| |||| || |||| ||| u
3'       ccuccu ucuc cg uccg ucu g
   ----ga      -    c  -    u   c 
Get sequence
Deep sequencing
110 reads, 1.49 reads per million, 67 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 53198889-53198945 [-]
antisense
OTTHUMT00000468383 ; RP11-258C19.7-001; exon 1
ENST00000603385 ; RP11-258C19.7-001; exon 1
Clustered miRNAs
< 10kb from hsa-mir-6894
hsa-mir-6894chrX: 53198889-53198945 [-]
hsa-mir-6895chrX: 53195411-53195488 [-]
Database links

Mature sequence hsa-miR-6894-5p

Accession MIMAT0027688
Sequence

6 - 

aggaggauggagagcugggccaga

 - 29

Get sequence
Deep sequencing64 reads, 42 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6894-3p

Accession MIMAT0027689
Sequence

37 - 

uugccugcccucuuccuccag

 - 57

Get sequence
Deep sequencing44 reads, 30 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).