Stem-loop sequence hsa-mir-6893

AccessionMI0022740 (change log)
Symbol HGNC:MIR6893
DescriptionHomo sapiens miR-6893 stem-loop
Literature search

1 open access papers mention hsa-mir-6893
(1 sentences)

Stem-loop
   ccg      --c    -       -------      ca 
5'    ggcagg   aggu guagggu       ggagcc  c
      ||||||   |||| |||||||       ||||||   
3'    ccgucc   uccg cgucccg       ccucgg  u
   -ga      acu    u       acucagu      ug 
Get sequence
Deep sequencing
43 reads, 0 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 144435551-144435619 [-]
sense
OTTHUMT00000381248 ; TOP1MT-002; intron 1
OTTHUMT00000381331 ; TOP1MT-020; intron 1
OTTHUMT00000381294 ; TOP1MT-003; intron 2
OTTHUMT00000381327 ; TOP1MT-011; intron 2
OTTHUMT00000381300 ; TOP1MT-004; intron 2
OTTHUMT00000381330 ; TOP1MT-010; intron 3
ENST00000519148 ; TOP1MT-002; intron 1
ENST00000518760 ; TOP1MT-020; intron 1
ENST00000521193 ; TOP1MT-003; intron 2
ENST00000520950 ; TOP1MT-011; intron 2
ENST00000505857 ; TOP1MT-004; intron 2
ENST00000521024 ; TOP1MT-010; intron 3
Database links

Mature sequence hsa-miR-6893-5p

Accession MIMAT0027686
Sequence

6 - 

caggcagguguaggguggagc

 - 26

Get sequence
Deep sequencing17 reads, 11 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6893-3p

Accession MIMAT0027687
Sequence

48 - 

cccugcugccuucaccugccag

 - 69

Get sequence
Deep sequencing9 reads, 7 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).