Stem-loop sequence hsa-mir-6892

AccessionMI0022739 (change log)
Symbol HGNC:MIR6892
DescriptionHomo sapiens miR-6892 stem-loop
Stem-loop
   guaagggaccggagaguaggaaaagcagggcucagggcca      cugg   uagaacua          
5'                                         gagaga    gca        aggaggaug 
                                           ||||||    |||        |||||||| g
3'                                         cucucu    cgu        uccuccugu 
   ------------------gacguuccccacccucucccuu      ---a   -----cag          
Get sequence
Deep sequencing
326 reads, 35.4 reads per million, 99 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 143382686-143382800 [+]
sense
OTTHUMT00000342152 ; FAM115C-003; intron 1
OTTHUMT00000381040 ; FAM115C-005; intron 1
OTTHUMT00000330279 ; FAM115C-002; intron 1
OTTHUMT00000330287 ; FAM115C-001; intron 1
ENST00000444908 ; FAM115C-003; intron 1
ENST00000518791 ; FAM115C-005; intron 1
ENST00000357344 ; FAM115C-002; intron 1
ENST00000441159 ; FAM115C-001; intron 1
ENST00000411497 ; FAM115C-202; intron 1
ENST00000456362 ; FAM115D-201; intron 1
antisense
ENST00000422705 ; RP11-61L23.2-203; intron 1
ENST00000450076 ; RP11-61L23.2-201; intron 2
ENST00000427403 ; RP11-61L23.2-202; intron 2
Database links

Mature sequence hsa-miR-6892-5p

Accession MIMAT0027684
Sequence

1 - 

guaagggaccggagaguagga

 - 21

Get sequence
Deep sequencing191 reads, 53 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6892-3p

Accession MIMAT0027685
Sequence

95 - 

ucccucucccaccccuugcag

 - 115

Get sequence
Deep sequencing21 reads, 16 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).