Stem-loop sequence hsa-mir-6891

AccessionMI0022738 (change log)
Symbol HGNC:MIR6891
DescriptionHomo sapiens miR-6891 stem-loop
Literature search

2 open access papers mention hsa-mir-6891
(3 sentences)

Stem-loop
   ----gu         --           auau    u  c    aaa  a 
5'       aaggagggg  gaugagggguc    cucu cu aggg   gc g
         |||||||||  |||||||||||    |||| || ||||   ||  
3'       uuccucccc  cuacuccccgg    ggga ga uucc   cg g
   gacccu         uu           gacu    c  c    ---  a 
Get sequence
Deep sequencing
157 reads, 12.3 reads per million, 57 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 31355224-31355316 [-]
intergenic
Database links

Mature sequence hsa-miR-6891-5p

Accession MIMAT0027682
Sequence

2 - 

uaaggagggggaugagggg

 - 20

Get sequence
Deep sequencing119 reads, 39 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6891-3p

Accession MIMAT0027683
Sequence

69 - 

cccucaucuuccccuccuuuc

 - 89

Get sequence
Deep sequencing15 reads, 12 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).