Stem-loop sequence hsa-mir-6890

AccessionMI0022737 (change log)
Symbol HGNC:MIR6890
DescriptionHomo sapiens miR-6890 stem-loop
Stem-loop
   ugggcca       -      agua     gga 
5'        uggggua gggcag    gggcu   u
          ||||||| ||||||    |||||   g
3'        accccgu uccguc    cccgg   g
   ----gac       a      ---a     gau 
Get sequence
Deep sequencing
36 reads, 0 reads per million, 19 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 49099854-49099914 [-]
sense
OTTHUMT00000345669 ; QRICH1-001; intron 2
OTTHUMT00000345671 ; QRICH1-003; intron 3
OTTHUMT00000345672 ; QRICH1-004; intron 3
ENST00000395443 ; QRICH1-001; intron 2
ENST00000357496 ; QRICH1-003; intron 3
ENST00000424300 ; QRICH1-004; intron 3
Database links

Mature sequence hsa-miR-6890-5p

Accession MIMAT0027680
Sequence

6 - 

caugggguagggcagaguagg

 - 26

Get sequence
Deep sequencing33 reads, 18 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6890-3p

Accession MIMAT0027681
Sequence

42 - 

ccacugccuaugccccacag

 - 61

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).