Stem-loop sequence hsa-mir-6889

AccessionMI0022736 (change log)
Symbol HGNC:MIR6889
DescriptionHomo sapiens miR-6889 stem-loop
Stem-loop
   cuguguc       cu    uc    -a   u 
5'        ggggagu  gggg  cgga  uuc c
          |||||||  ||||  ||||  |||  
3'        cccuuca  cccc  gucu  gag c
   -----ga       -u    gu    cc   a 
Get sequence
Deep sequencing
40 reads, 0 reads per million, 26 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 41252992-41253050 [-]
sense
OTTHUMT00000321759 ; ST13-001; 5'UTR (exon 1)
ENST00000216218 ; ST13-001; 5'UTR (exon 1)
Database links

Mature sequence hsa-miR-6889-5p

Accession MIMAT0027678
Sequence

6 - 

ucggggagucugggguccggaau

 - 28

Get sequence
Deep sequencing29 reads, 20 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6889-3p

Accession MIMAT0027679
Sequence

40 - 

ucugugccccuacuucccag

 - 59

Get sequence
Deep sequencing9 reads, 7 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).