Stem-loop sequence hsa-mir-6888

AccessionMI0022735 (change log)
Symbol HGNC:MIR6888
DescriptionHomo sapiens miR-6888 stem-loop
Literature search

1 open access papers mention hsa-mir-6888
(1 sentences)

Stem-loop
   gugggaa      gc  -          gucucug 
5'        ggagau  uc aggcagaucu       a
          ||||||  || ||||||||||       u
3'        ccuuug  ag ucugucuaga       u
   -----ga      uu  c          accuuug 
Get sequence
Deep sequencing
48 reads, 2.94 reads per million, 34 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 159186835-159186901 [+]
antisense
OTTHUMT00000333274 ; CCDC148-005; intron 2
OTTHUMT00000333275 ; CCDC148-006; intron 5
OTTHUMT00000333271 ; CCDC148-002; intron 5
OTTHUMT00000333272 ; CCDC148-003; intron 6
OTTHUMT00000333270 ; CCDC148-001; intron 7
OTTHUMT00000333276 ; CCDC148-007; intron 8
ENST00000454257 ; CCDC148-005; intron 2
ENST00000448656 ; CCDC148-006; intron 5
ENST00000417066 ; CCDC148-002; intron 5
ENST00000536771 ; CCDC148-201; intron 5
ENST00000451554 ; CCDC148-003; intron 6
ENST00000283233 ; CCDC148-001; intron 7
ENST00000409187 ; CCDC148-007; intron 8
Database links

Mature sequence hsa-miR-6888-5p

Accession MIMAT0027676
Sequence

6 - 

aaggagaugcucaggcagau

 - 25

Get sequence
Deep sequencing21 reads, 17 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6888-3p

Accession MIMAT0027677
Sequence

47 - 

aucugucucgauuguuuccag

 - 67

Get sequence
Deep sequencing15 reads, 11 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).