Stem-loop sequence hsa-mir-6885

AccessionMI0022732 (change log)
Symbol HGNC:MIR6885
DescriptionHomo sapiens miR-6885 stem-loop
Literature search

1 open access papers mention hsa-mir-6885
(1 sentences)

Stem-loop
   ccugg         cu c c          ---a  g 
5'      aggggggca  g g aagcaaagcc    gg a
        |||||||||  | | ||||||||||    ||  
3'      uccccucgu  c c uucguuucgg    uc c
   ---ga         -- - -          agag  c 
Get sequence
Deep sequencing
162 reads, 0 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 6389638-6389703 [-]
sense
OTTHUMT00000453041 ; CTB-180A7.6-001; intron 1
OTTHUMT00000398036 ; GTF2F1-006; exon 2
OTTHUMT00000398033 ; GTF2F1-001; exon 4
OTTHUMT00000398035 ; GTF2F1-005; exon 5
OTTHUMT00000398037 ; GTF2F1-003; exon 5
ENST00000599584 ; CTB-180A7.6-001; intron 1
ENST00000593678 ; GTF2F1-006; exon 2
ENST00000429701 ; GTF2F1-201; exon 2
ENST00000394456 ; GTF2F1-001; exon 4
ENST00000595047 ; GTF2F1-005; exon 5
ENST00000598607 ; GTF2F1-003; exon 5
Clustered miRNAs
< 10kb from hsa-mir-6885
hsa-mir-6790chr19: 6392921-6392983 [-]
hsa-mir-6885chr19: 6389638-6389703 [-]
Database links

Mature sequence hsa-miR-6885-5p

Accession MIMAT0027670
Sequence

6 - 

aggggggcacugcgcaagcaaagcc

 - 30

Get sequence
Deep sequencing135 reads, 20 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6885-3p

Accession MIMAT0027671
Sequence

46 - 

cuuugcuuccugcuccccuag

 - 66

Get sequence
Deep sequencing21 reads, 12 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).