Stem-loop sequence hsa-mir-6884

AccessionMI0022731 (change log)
Symbol HGNC:MIR6884
DescriptionHomo sapiens miR-6884 stem-loop
Stem-loop
   cccgca     u ag         uu    - aagaaagg 
5'       gaggc g  aaggugaug  ggcu c        g
         ||||| |  |||||||||  |||| |         
3'       cucug c  uuccacuac  ccga g        a
   gauccc     - cu         --    u guagauag 
Get sequence
Deep sequencing
192 reads, 0 reads per million, 52 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 40026332-40026409 [-]
sense
OTTHUMT00000449111 ; ACLY-009; intron 1
OTTHUMT00000449110 ; ACLY-004; intron 17
OTTHUMT00000257466 ; ACLY-002; intron 24
OTTHUMT00000257465 ; ACLY-001; intron 25
OTTHUMT00000449109 ; ACLY-003; intron 25
ENST00000588779 ; ACLY-009; intron 1
ENST00000537919 ; ACLY-004; intron 17
ENST00000393896 ; ACLY-002; intron 24
ENST00000353196 ; ACLY-201; intron 24
ENST00000352035 ; ACLY-001; intron 25
ENST00000590151 ; ACLY-003; intron 25
Database links

Mature sequence hsa-miR-6884-5p

Accession MIMAT0027668
Sequence

6 - 

agaggcugagaaggugauguug

 - 27

Get sequence
Deep sequencing177 reads, 48 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6884-3p

Accession MIMAT0027669
Sequence

54 - 

cccaucaccuuuccgucuccccu

 - 76

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).