Stem-loop sequence hsa-mir-6883

AccessionMI0022730 (change log)
Symbol HGNC:MIR6883
DescriptionHomo sapiens miR-6883 stem-loop
Literature search

1 open access papers mention hsa-mir-6883
(1 sentences)

Stem-loop
   cagaca         u    u   ugu   -----    c u 
5'       gggagggug ggua gga   guu     gacc c g
         ||||||||| |||| |||   |||     |||| |  
3'       uccucucac cuau ccu   cag     uugg g a
   ---gac         u    c   uuc   uaguc    u a 
Get sequence
Deep sequencing
126 reads, 0 reads per million, 35 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 8144994-8145071 [-]
sense
OTTHUMT00000442018 ; CTC1-004; intron 1
OTTHUMT00000442019 ; CTC1-005; intron 1
OTTHUMT00000442011 ; CTC1-002; intron 2
OTTHUMT00000442012 ; CTC1-001; intron 2
ENST00000581671 ; CTC1-004; intron 1
ENST00000584842 ; CTC1-005; intron 1
ENST00000449476 ; CTC1-002; intron 2
ENST00000315684 ; CTC1-001; intron 2
Database links

Mature sequence hsa-miR-6883-5p

Accession MIMAT0027666
Sequence

6 - 

agggagggugugguauggaugu

 - 27

Get sequence
Deep sequencing8 reads, 8 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6883-3p

Accession MIMAT0027667
Sequence

57 - 

uucccuaucucacucuccucag

 - 78

Get sequence
Deep sequencing27 reads, 19 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).