Stem-loop sequence hsa-mir-6882

AccessionMI0022729 (change log)
Symbol HGNC:MIR6882
DescriptionHomo sapiens miR-6882 stem-loop
Stem-loop
   ggcuuuaca  u      cu  a     u  aau 
5'          ag caggag  ga gcagc gg   u
            || ||||||  || ||||| ||   c
3'          uc guucuc  cu cgucg cc   a
   -----gacg  c      cu  c     u  cga 
Get sequence
Deep sequencing
754 reads, 29.6 reads per million, 108 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 74840642-74840707 [-]
antisense
OTTHUMT00000420639 ; ARID3B-004; intron 1
OTTHUMT00000280688 ; ARID3B-001; intron 2
OTTHUMT00000420638 ; ARID3B-002; intron 2
ENST00000566147 ; ARID3B-004; intron 1
ENST00000346246 ; ARID3B-001; intron 2
ENST00000569680 ; ARID3B-002; intron 2
Database links

Mature sequence hsa-miR-6882-5p

Accession MIMAT0027664
Sequence

6 - 

uacaagucaggagcugaagcag

 - 27

Get sequence
Deep sequencing724 reads, 101 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6882-3p

Accession MIMAT0027665
Sequence

43 - 

ugcugccucuccucuugccugcag

 - 66

Get sequence
Deep sequencing26 reads, 19 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).