Stem-loop sequence hsa-mir-6881

AccessionMI0022728 (change log)
Symbol HGNC:MIR6881
DescriptionHomo sapiens miR-6881 stem-loop
Stem-loop
   ugca       ---      --           -guc   ag 
5'     cuggggu   aaggau  aggagggucag    ugc  c
       |||||||   ||||||  |||||||||||    |||   
3'     gaccuca   uuccug  uucuccuaguc    aug  c
   ----       ccc      cu           gucu   uu 
Get sequence
Deep sequencing
57 reads, 0 reads per million, 32 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 74411357-74411432 [-]
antisense
OTTHUMT00000421941 ; ISLR2-008; intron 2
ENST00000561975 ; ISLR2-008; intron 2
Database links

Mature sequence hsa-miR-6881-5p

Accession MIMAT0027662
Sequence

6 - 

ugggguaaggauaggaggguca

 - 27

Get sequence
Deep sequencing22 reads, 12 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6881-3p

Accession MIMAT0027663
Sequence

51 - 

auccucuuucguccuucccacu

 - 72

Get sequence
Deep sequencing25 reads, 18 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).