Stem-loop sequence hsa-mir-6880

AccessionMI0022727 (change log)
Symbol HGNC:MIR6880
DescriptionHomo sapiens miR-6880 stem-loop
Stem-loop
   ga   u  u    -    -----a      - uc 
5'   ggg gg ggag gaag      gggcag c  c
     ||| || |||| ||||      |||||| |   
3'   ccc cc ccuc cuuc      uccguc g  c
   ga   -  u    u    cgccag      a ua 
Get sequence
Deep sequencing
71 reads, 2.22 reads per million, 45 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 124337181-124337242 [-]
antisense
OTTHUMT00000335421 ; DNAH10-002; intron 8
OTTHUMT00000335420 ; DNAH10-001; intron 34
ENST00000497783 ; DNAH10-002; intron 8
ENST00000409039 ; DNAH10-001; intron 34
Database links

Mature sequence hsa-miR-6880-5p

Accession MIMAT0027660
Sequence

6 - 

ugguggaggaagagggcagcuc

 - 27

Get sequence
Deep sequencing58 reads, 36 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6880-3p

Accession MIMAT0027661
Sequence

42 - 

ccgccuucucuccucccccag

 - 62

Get sequence
Deep sequencing12 reads, 10 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).