Stem-loop sequence hsa-mir-6879

AccessionMI0022726 (change log)
Symbol HGNC:MIR6879
DescriptionHomo sapiens miR-6879 stem-loop
Stem-loop
   cagagca         --a     g  -    gccc 
5'        gggcaggga   ggugg ag aggg    a
          |||||||||   ||||| || ||||     
3'        cccguuccu   ccacu uc uccc    g
   -----ga         cgc     g  c    aguc 
Get sequence
Deep sequencing
69 reads, 162 reads per million, 40 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 65018505-65018570 [+]
intergenic
Database links

Mature sequence hsa-miR-6879-5p

Accession MIMAT0027658
Sequence

6 - 

cagggcagggaaggugggagag

 - 27

Get sequence
Deep sequencing40 reads, 29 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6879-3p

Accession MIMAT0027659
Sequence

46 - 

ugucacccgcuccuugcccag

 - 66

Get sequence
Deep sequencing20 reads, 13 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).