Stem-loop sequence hsa-mir-6878

AccessionMI0022725 (change log)
Symbol HGNC:MIR6878
DescriptionHomo sapiens miR-6878 stem-loop
Literature search

1 open access papers mention hsa-mir-6878
(3 sentences)

Stem-loop
   augaga         cu   a   ga  a uc  a 
5'       gggagaaag  aga gcu  ag u  ug a
         |||||||||  ||| |||  || |  || a
3'       uccucuuuc  ucu cgg  uc a  ac a
   ----ga         -u   c   --  a uc  u 
Get sequence
Deep sequencing
58 reads, 69.4 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 150492345-150492410 [+]
intergenic
Database links

Mature sequence hsa-miR-6878-5p

Accession MIMAT0027656
Sequence

6 - 

agggagaaagcuagaagcugaag

 - 28

Get sequence
Deep sequencing25 reads, 19 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6878-3p

Accession MIMAT0027657
Sequence

46 - 

cuggccucuucuuucuccuag

 - 66

Get sequence
Deep sequencing15 reads, 14 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).