Stem-loop sequence hsa-mir-6877

AccessionMI0022724 (change log)
Symbol HGNC:MIR6877
DescriptionHomo sapiens miR-6877 stem-loop
Stem-loop
   aguuca     g     ug  a    cu   g 
5'       gggcc aaggg  ga gcug  ggu c
         ||||| |||||  || ||||  |||  
3'       uccgg uuccc  cu cgac  cua u
   gacccc     -     gu  c    -u   c 
Get sequence
Deep sequencing
373 reads, 0 reads per million, 92 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 133051996-133052059 [+]
sense
OTTHUMT00000276096 ; HMCN2-002; intron 3
ENST00000415566 ; HMCN2-002; intron 3
Database links

Mature sequence hsa-miR-6877-5p

Accession MIMAT0027654
Sequence

6 - 

agggccgaaggguggaagcugc

 - 27

Get sequence
Deep sequencing344 reads, 81 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6877-3p

Accession MIMAT0027655
Sequence

40 - 

cagccucugcccuuggccucc

 - 60

Get sequence
Deep sequencing12 reads, 11 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).