Stem-loop sequence hsa-mir-6876

AccessionMI0022723 (change log)
Symbol HGNC:MIR6876
DescriptionHomo sapiens miR-6876 stem-loop
Stem-loop
   aguugca        ---            g ag ug    
5'        ggaaggag   acaggcaguuca g  g  gca 
          ||||||||   |||||||||||| |  |  || c
3'        ucuuccuu   ugucugucgagu u  u  cgu 
   ----gac        uug            g -g gu    
Get sequence
Deep sequencing
45 reads, 12.1 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 25345402-25345474 [+]
sense
OTTHUMT00000375932 ; CDCA2-006; intron 6
OTTHUMT00000375812 ; CDCA2-002; intron 11
OTTHUMT00000216891 ; CDCA2-001; intron 12
ENST00000521098 ; CDCA2-006; intron 6
ENST00000380665 ; CDCA2-002; intron 11
ENST00000330560 ; CDCA2-001; intron 12
Database links

Mature sequence hsa-miR-6876-5p

Accession MIMAT0027652
Sequence

6 - 

caggaaggagacaggcaguuca

 - 27

Get sequence
Deep sequencing20 reads, 17 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6876-3p

Accession MIMAT0027653
Sequence

50 - 

agcugucuguguuuuccuucucag

 - 73

Get sequence
Deep sequencing18 reads, 16 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).