Stem-loop sequence hsa-mir-6874

AccessionMI0022721 (change log)
Symbol HGNC:MIR6874
DescriptionHomo sapiens miR-6874 stem-loop
Stem-loop
   gccaca     cu     --    ------------      uu 
5'       uggag  ggaac  caga            ucaggc  u
         |||||  |||||  ||||            ||||||   
3'       aucuc  ucuug  gucu            aguuug  a
   -----g     ag     uc    ugacuguaauga      ua 
Get sequence
Deep sequencing
91 reads, 18.2 reads per million, 44 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 5711840-5711910 [-]
sense
OTTHUMT00000340371 ; AC006483.7-001; intron 1
OTTHUMT00000340382 ; RNF216-009; intron 3
OTTHUMT00000340377 ; RNF216-004; intron 12
OTTHUMT00000340374 ; RNF216-001; intron 13
OTTHUMT00000340376 ; RNF216-003; intron 13
ENST00000443837 ; RNF216-IT1-001; intron 1
ENST00000484458 ; RNF216-009; intron 3
ENST00000389900 ; RNF216-004; intron 12
ENST00000425013 ; RNF216-001; intron 13
ENST00000389902 ; RNF216-003; intron 13
Database links

Mature sequence hsa-miR-6874-5p

Accession MIMAT0027648
Sequence

6 - 

auggagcuggaaccagaucaggc

 - 28

Get sequence
Deep sequencing44 reads, 15 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6874-3p

Accession MIMAT0027649
Sequence

49 - 

caguucugcuguucugacucuag

 - 71

Get sequence
Deep sequencing47 reads, 33 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).