Stem-loop sequence hsa-mir-6873

AccessionMI0022720 (change log)
Symbol HGNC:MIR6873
DescriptionHomo sapiens miR-6873 stem-loop
Stem-loop
   ccca c        -u        c   cag     
5'     g agagggaa  acagaggg aau   gacu 
       | ||||||||  |||||||| |||   ||| g
3'     c ucucucuu  ugucucuc uua   cugg 
   --ga -        uc        -   ---     
Get sequence
Deep sequencing
1219 reads, 72.6 reads per million, 95 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 33287227-33287289 [-]
sense
OTTHUMT00000076404 ; DAXX-002; exon 6
OTTHUMT00000076403 ; DAXX-001; exon 6
ENST00000414083 ; DAXX-201; exon 5
ENST00000266000 ; DAXX-002; exon 6
ENST00000374542 ; DAXX-001; exon 6
Clustered miRNAs
< 10kb from hsa-mir-6873
hsa-mir-6834chr6: 33290245-33290325 [+]
hsa-mir-6873chr6: 33287227-33287289 [-]
Database links

Mature sequence hsa-miR-6873-5p

Accession MIMAT0027646
Sequence

6 - 

cagagggaauacagagggcaau

 - 27

Get sequence
Deep sequencing17 reads, 15 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6873-3p

Accession MIMAT0027647
Sequence

41 - 

uucucucugucuuucucucucag

 - 63

Get sequence
Deep sequencing1194 reads, 86 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).