Stem-loop sequence hsa-mir-6872

AccessionMI0022719 (change log)
Symbol HGNC:MIR6872
DescriptionHomo sapiens miR-6872 stem-loop
Stem-loop
   gugg u u   au         a  -c   ga 
5'     g c cgc  caggaggca gg  cag  c
       | | |||  ||||||||| ||  |||   
3'     c g gcg  guccuccgu cc  guc  c
   --ga u -   cc         a  ca   gc 
Get sequence
Deep sequencing
14 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 50273236-50273297 [+]
sense
OTTHUMT00000346690 ; GNAI2-003; intron 1
OTTHUMT00000346691 ; GNAI2-004; intron 1
OTTHUMT00000346694 ; GNAI2-007; intron 1
ENST00000422163 ; GNAI2-003; intron 1
ENST00000446079 ; GNAI2-004; intron 1
ENST00000491100 ; GNAI2-007; intron 1
Database links

Mature sequence hsa-miR-6872-5p

Accession MIMAT0027644
Sequence

6 - 

ucucgcaucaggaggcaagg

 - 25

Get sequence
Deep sequencing9 reads, 7 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6872-3p

Accession MIMAT0027645
Sequence

40 - 

cccaugccuccugccgcgguc

 - 60

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).