Stem-loop sequence hsa-mir-6871

AccessionMI0022718 (change log)
Symbol HGNC:MIR6871
DescriptionHomo sapiens miR-6871 stem-loop
Stem-loop
   cuccuca        -       g u  u 
5'        ugggaguu cggggug u gc g
          |||||||| ||||||| | || g
3'        acccucgg gucccac a ug a
   ----gac        u       g c  g 
Get sequence
Deep sequencing
72 reads, 0 reads per million, 41 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 41169023-41169078 [+]
antisense
OTTHUMT00000080315 ; PTPRT-002; intron 7
OTTHUMT00000080317 ; PTPRT-004; intron 7
OTTHUMT00000080319 ; PTPRT-006; intron 7
OTTHUMT00000080314 ; PTPRT-001; intron 7
OTTHUMT00000080316 ; PTPRT-003; intron 7
OTTHUMT00000080318 ; PTPRT-005; intron 7
OTTHUMT00000080320 ; PTPRT-007; intron 7
ENST00000373187 ; PTPRT-002; intron 7
ENST00000356100 ; PTPRT-004; intron 7
ENST00000373184 ; PTPRT-006; intron 7
ENST00000373190 ; PTPRT-001; intron 7
ENST00000373193 ; PTPRT-003; intron 7
ENST00000373198 ; PTPRT-005; intron 7
ENST00000373201 ; PTPRT-007; intron 7
Database links

Mature sequence hsa-miR-6871-5p

Accession MIMAT0027642
Sequence

6 - 

caugggaguucggggugguugc

 - 27

Get sequence
Deep sequencing48 reads, 36 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6871-3p

Accession MIMAT0027643
Sequence

35 - 

cagcacccuguggcucccacag

 - 56

Get sequence
Deep sequencing20 reads, 9 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).