Stem-loop sequence hsa-mir-6870

AccessionMI0022717 (change log)
Symbol HGNC:MIR6870
DescriptionHomo sapiens miR-6870 stem-loop
Stem-loop
   caaggu               u  a uucau 
5'       gggggagaugggggu ga c     u
         ||||||||||||||| || |      
3'       uuuccucuaccccua cu g     u
   ---gac               -  c uacuc 
Get sequence
Deep sequencing
57 reads, 2.7 reads per million, 37 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 10649636-10649695 [-]
sense
ENST00000254958 ; JAG1-201; intron 2
Database links

Mature sequence hsa-miR-6870-5p

Accession MIMAT0027640
Sequence

6 - 

ugggggagauggggguuga

 - 24

Get sequence
Deep sequencing21 reads, 15 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6870-3p

Accession MIMAT0027641
Sequence

39 - 

gcucauccccaucuccuuucag

 - 60

Get sequence
Deep sequencing15 reads, 10 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).