Stem-loop sequence hsa-mir-6869

AccessionMI0022716 (change log)
Symbol HGNC:MIR6869
DescriptionHomo sapiens miR-6869 stem-loop
Stem-loop
   -----g     agug            uc      
5'       ugagu    gcgcgcggcggc  ggagu 
         |||||    ||||||||||||  |||| a
3'       acucg    cgcgcgccgccg  ucucc 
   cguacg     gcua            --      
Get sequence
Deep sequencing
447 reads, 0 reads per million, 80 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 1392900-1392961 [-]
intergenic
Database links

Mature sequence hsa-miR-6869-5p

Accession MIMAT0027638
Sequence

1 - 

gugaguaguggcgcgcggcggc

 - 22

Get sequence
Deep sequencing191 reads, 69 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6869-3p

Accession MIMAT0027639
Sequence

38 - 

cgccgcgcgcaucggcucagc

 - 58

Get sequence
Deep sequencing21 reads, 10 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).