Stem-loop sequence hsa-mir-6868

AccessionMI0022715 (change log)
Symbol HGNC:MIR6868
DescriptionHomo sapiens miR-6868 stem-loop
Stem-loop
   ccagga   -     ac  u    -c     g 
5'       cug gcaga  ac gaag  agcag c
         ||| |||||  || ||||  |||||  
3'       gac ugucu  ug cuuc  ucguc a
   ------   g     gu  u    cu     c 
Get sequence
Deep sequencing
114 reads, 0 reads per million, 32 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 76098019-76098076 [-]
antisense
OTTHUMT00000437206 ; TNRC6C-006; intron 1
OTTHUMT00000395947 ; TNRC6C-002; intron 19
OTTHUMT00000255891 ; TNRC6C-001; intron 20
ENST00000592566 ; TNRC6C-006; intron 1
ENST00000541771 ; TNRC6C-203; intron 15
ENST00000544502 ; TNRC6C-204; intron 16
ENST00000301624 ; TNRC6C-201; intron 17
ENST00000335749 ; TNRC6C-202; intron 18
ENST00000588061 ; TNRC6C-002; intron 19
ENST00000588847 ; TNRC6C-001; intron 20
Database links

Mature sequence hsa-miR-6868-5p

Accession MIMAT0027636
Sequence

6 - 

acuggcagaacacugaagcagc

 - 27

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6868-3p

Accession MIMAT0027637
Sequence

38 - 

uuccuucuguugucugugcag

 - 58

Get sequence
Deep sequencing110 reads, 31 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).