Stem-loop sequence hsa-mir-6867

AccessionMI0022714 (change log)
Symbol HGNC:MIR6867
DescriptionHomo sapiens miR-6867 stem-loop
Stem-loop
   ccc    u u   u     a   a  ga  cu  g 
5'    ggug g gug agagg aga gg  ag  gg a
      |||| | ||| ||||| ||| ||  ||  ||  
3'    ucac c cau ucucc ucu cc  uc  uc a
   -ga    - -   u     c   -  -g  ag  c 
Get sequence
Deep sequencing
80 reads, 4.55 reads per million, 44 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 40193597-40193663 [+]
antisense
OTTHUMT00000347740 ; ZNF385C-001; intron 1
OTTHUMT00000449775 ; CTD-2132N18.2-001; intron 1
ENST00000436535 ; ZNF385C-001; intron 1
ENST00000587304 ; CTD-2132N18.2-001; intron 1
Database links

Mature sequence hsa-miR-6867-5p

Accession MIMAT0027634
Sequence

6 - 

uguguguguagaggaagaaggga

 - 28

Get sequence
Deep sequencing55 reads, 27 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6867-3p

Accession MIMAT0027635
Sequence

47 - 

cucucccucuuuacccacuag

 - 67

Get sequence
Deep sequencing11 reads, 9 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).