Stem-loop sequence hsa-mir-6866

AccessionMI0022713 (change log)
Symbol HGNC:MIR6866
DescriptionHomo sapiens miR-6866 stem-loop
Literature search

1 open access papers mention hsa-mir-6866
(2 sentences)

Stem-loop
   ccauuu      c    -au  a        agg  u 
5'       uagagg ugga   ag gauucuug   cu g
         |||||| ||||   || ||||||||   ||  
3'       aucucc gucu   uc cuaggaau   ga g
   -----g      u    auu  c        -ga  a 
Get sequence
Deep sequencing
393 reads, 0 reads per million, 103 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 40161933-40162001 [+]
antisense
OTTHUMT00000453366 ; DNAJC7-001; intron 1
OTTHUMT00000453368 ; DNAJC7-005; intron 1
OTTHUMT00000453369 ; DNAJC7-002; intron 1
OTTHUMT00000453370 ; DNAJC7-003; intron 1
OTTHUMT00000453375 ; DNAJC7-006; intron 1
OTTHUMT00000453376 ; DNAJC7-013; intron 1
OTTHUMT00000453377 ; DNAJC7-010; intron 1
OTTHUMT00000453379 ; DNAJC7-014; intron 1
OTTHUMT00000453380 ; DNAJC7-017; intron 1
OTTHUMT00000453381 ; DNAJC7-015; intron 1
OTTHUMT00000453382 ; DNAJC7-012; intron 1
OTTHUMT00000453383 ; DNAJC7-011; intron 1
OTTHUMT00000453384 ; DNAJC7-018; intron 1
OTTHUMT00000453385 ; DNAJC7-009; intron 1
OTTHUMT00000453386 ; DNAJC7-016; intron 1
ENST00000457167 ; DNAJC7-001; intron 1
ENST00000426588 ; DNAJC7-005; intron 1
ENST00000588814 ; DNAJC7-002; intron 1
ENST00000316603 ; DNAJC7-003; intron 1
ENST00000589810 ; DNAJC7-006; intron 1
ENST00000588641 ; DNAJC7-013; intron 1
ENST00000590348 ; DNAJC7-010; intron 1
ENST00000589576 ; DNAJC7-014; intron 1
ENST00000590774 ; DNAJC7-017; intron 1
ENST00000589586 ; DNAJC7-015; intron 1
ENST00000585866 ; DNAJC7-012; intron 1
ENST00000589773 ; DNAJC7-011; intron 1
ENST00000590886 ; DNAJC7-018; intron 1
ENST00000591787 ; DNAJC7-009; intron 1
ENST00000589547 ; DNAJC7-016; intron 1
Database links

Mature sequence hsa-miR-6866-5p

Accession MIMAT0027632
Sequence

6 - 

uuagaggcuggaauagagauucu

 - 28

Get sequence
Deep sequencing362 reads, 98 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6866-3p

Accession MIMAT0027633
Sequence

48 - 

gaucccuuuaucuguccucuag

 - 69

Get sequence
Deep sequencing26 reads, 11 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).