Stem-loop sequence hsa-mir-6865

AccessionMI0022712 (change log)
Symbol HGNC:MIR6865
DescriptionHomo sapiens miR-6865 stem-loop
Literature search

2 open access papers mention hsa-mir-6865
(4 sentences)

Stem-loop
   aucca       c  ---       acu   -  u 
5'      uaggugg ag   aggaggg   uca ga g
        ||||||| ||   |||||||   ||| ||  
3'      auccgcc uc   uucuccc   agu cu c
   --gac       a  ccu       -ac   a  u 
Get sequence
Deep sequencing
86 reads, 0 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 4970086-4970150 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-6865
hsa-mir-6865chr17: 4970086-4970150 [-]
hsa-mir-6864chr17: 4969702-4969771 [-]
Database links

Mature sequence hsa-miR-6865-5p

Accession MIMAT0027630
Sequence

6 - 

uagguggcagaggagggacuuca

 - 28

Get sequence
Deep sequencing64 reads, 32 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6865-3p

Accession MIMAT0027631
Sequence

40 - 

acacccucuuucccuaccgcc

 - 60

Get sequence
Deep sequencing19 reads, 15 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).