Stem-loop sequence hsa-mir-6864

AccessionMI0022711 (change log)
Symbol HGNC:MIR6864
DescriptionHomo sapiens miR-6864 stem-loop
Stem-loop
   gaaagu        --c     agaua    a     u 
5'       ugaaggga   aaguc     ugcc uuaug g
         ||||||||   |||||     |||| ||||| g
3'       acuucccu   uucag     gugg aguac g
   -----g        cuc     -agug    -     u 
Get sequence
Deep sequencing
62 reads, 0 reads per million, 35 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 4969702-4969771 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-6864
hsa-mir-6865chr17: 4970086-4970150 [-]
hsa-mir-6864chr17: 4969702-4969771 [-]
Database links

Mature sequence hsa-miR-6864-5p

Accession MIMAT0027628
Sequence

6 - 

uugaagggacaagucagauaugcc

 - 29

Get sequence
Deep sequencing49 reads, 27 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6864-3p

Accession MIMAT0027629
Sequence

50 - 

gugagacuucucucccuucag

 - 70

Get sequence
Deep sequencing11 reads, 9 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).