Stem-loop sequence hsa-mir-6863

AccessionMI0022710 (change log)
Symbol HGNC:MIR6863
DescriptionHomo sapiens miR-6863 stem-loop
Stem-loop
   auuuaugaggcagcagagucuacaaguaaa    -g     aguugaaaauguuaaug 
5'                               ucau  aaucc                 a
                                 ||||  |||||                  
3'                               agug  uuagg                 g
   ---------------------------ucc    ag     aaguggugcagauaccg 
Get sequence
Deep sequencing
152 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 56904264-56904353 [+]
sense
OTTHUMT00000432335 ; SLC12A3-002; intron 5
OTTHUMT00000257064 ; SLC12A3-001; intron 5
OTTHUMT00000432337 ; SLC12A3-005; intron 5
OTTHUMT00000432338 ; SLC12A3-003; intron 5
ENST00000566786 ; SLC12A3-002; intron 5
ENST00000438926 ; SLC12A3-001; intron 5
ENST00000563236 ; SLC12A3-005; intron 5
ENST00000262502 ; SLC12A3-003; intron 5
Database links

Mature sequence hsa-miR-6863

Accession MIMAT0027627
Sequence

64 - 

uagacguggugaaggauugagug

 - 86

Get sequence
Deep sequencing119 reads, 1 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).