Stem-loop sequence hsa-mir-6862-1

AccessionMI0022709 (change log)
Symbol HGNC:MIR6862-1
DescriptionHomo sapiens miR-6862-1 stem-loop
Gene family MIPF0001855; mir-6862
Stem-loop
   cga  c    ----au      a   a     u  uu 
5'    ag gggc      gcuggg gag cuuug ga  u
      || ||||      |||||| ||| ||||| ||   
3'    uc cccg      cgaccc cuc gaaac cu  g
   -ga  u    gucucu      a   c     -  cu 
Get sequence
Deep sequencing
132 reads, 0 reads per million, 56 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 28390982-28391051 [-]
sense
OTTHUMT00000214116 ; EIF3CL-001; 3'UTR (exon 21)
ENST00000380876 ; EIF3CL-001; 3'UTR (exon 21)
ENST00000398944 ; EIF3CL-202; 3'UTR (exon 21)
ENST00000398943 ; EIF3CL-201; 3'UTR (exon 21)
Database links

Mature sequence hsa-miR-6862-5p

Accession MIMAT0027625
Sequence

6 - 

cgggcaugcugggagagacuuu

 - 27

Get sequence
Deep sequencing196 reads, 41 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6862-3p

Accession MIMAT0027626
Sequence

45 - 

ccucacccagcucucuggcccucu

 - 68

Get sequence
Deep sequencing52 reads, 19 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).