Stem-loop sequence hsa-mir-6859-1

AccessionMI0022705 (change log)
Symbol HGNC:MIR6859-1
DescriptionHomo sapiens miR-6859-1 stem-loop
Gene family MIPF0001698; mir-6859
Stem-loop
   ugug g     -a       -c     ac   ggg 
5'     g agagg  acauggg  ucagg  agc   u
       | |||||  |||||||  |||||  |||    
3'     u ucucc  uguaccc  agucc  ucg   g
   --ga g     gc       cc     gu   acu 
Get sequence
Deep sequencing
381 reads, 0 reads per million, 70 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 17369-17436 [-]
sense
OTTHUMT00000002839 ; WASH7P-001; intron 5
ENST00000423562 ; WASH7P-201; intron 4
ENST00000488147 ; WASH7P-001; intron 5
ENST00000538476 ; WASH7P-203; intron 5
ENST00000438504 ; WASH7P-202; intron 5
ENST00000541675 ; WASH7P-204; intron 5
Database links

Mature sequence hsa-miR-6859-5p

Accession MIMAT0027618
Sequence

6 - 

gagaggaacaugggcucaggaca

 - 28

Get sequence
Deep sequencing1388 reads, 54 experiments
Evidence experimental; meta-analysis [1]

Mature sequence hsa-miR-6859-3p

Accession MIMAT0027619
Sequence

46 - 

ugacccccaugucgccucuguag

 - 68

Get sequence
Deep sequencing124 reads, 25 experiments
Evidence experimental; meta-analysis [1]

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).