Stem-loop sequence hsa-mir-6858

AccessionMI0022704 (change log)
Symbol HGNC:MIR6858
DescriptionHomo sapiens miR-6858 stem-loop
Stem-loop
   --------     g          agggaccccucc 
5'         gugag aggggcuggc            a
           ||||| ||||||||||            a
3'         cacuc uccccgaccg            g
   ccgcuccc     g          acggcagggguu 
Get sequence
Deep sequencing
174 reads, 19.5 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 154450320-154450386 [+]
sense
OTTHUMT00000058806 ; VBP1-001; intron 2
ENST00000286428 ; VBP1-001; intron 2
ENST00000535916 ; VBP1-201; intron 3
Database links

Mature sequence hsa-miR-6858-5p

Accession MIMAT0027616
Sequence

1 - 

gugaggaggggcuggcagggac

 - 22

Get sequence
Deep sequencing101 reads, 50 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6858-3p

Accession MIMAT0027617
Sequence

42 - 

cagccagccccugcucaccccu

 - 63

Get sequence
Deep sequencing63 reads, 42 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).