Stem-loop sequence hsa-mir-6857

AccessionMI0022703 (change log)
Symbol HGNC:MIR6857
DescriptionHomo sapiens miR-6857 stem-loop
Literature search

1 open access papers mention hsa-mir-6857
(26 sentences)

Stem-loop
   gcu   u     uu  g    gc     uuca     cccuccuc   ua 
5'    ugu gggga  gg ucag  cagug    agggc        uag  c
      ||| |||||  || ||||  |||||    |||||        |||   
3'    aca ccccu  uc aguc  gucac    ucuug        guc  u
   --g   -     cu  g    -a     --cg     ---uguuu   cc 
Get sequence
Deep sequencing
101 reads, 0 reads per million, 35 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 53405673-53405765 [-]
sense
OTTHUMT00000056756 ; SMC1A-001; 3'UTR (exon 25)
ENST00000322213 ; SMC1A-001; 3'UTR (exon 25)
Database links

Mature sequence hsa-miR-6857-5p

Accession MIMAT0027614
Sequence

6 - 

uuggggauugggucaggccagu

 - 27

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6857-3p

Accession MIMAT0027615
Sequence

73 - 

ugacugagcuucuccccacag

 - 93

Get sequence
Deep sequencing81 reads, 21 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).