Stem-loop sequence hsa-mir-6856

AccessionMI0022702 (change log)
Symbol HGNC:MIR6856
DescriptionHomo sapiens miR-6856 stem-loop
Stem-loop
   -    aaa    gga   gu  u        agu   a 
5'  ugga   gaga   gca  gg gcuguggc   ggc g
    ||||   ||||   |||  || ||||||||   |||  
3'  accu   uucu   ugu  cc cgacaucg   cug a
   g    ---    -ag   --  -        ---   g 
Get sequence
Deep sequencing
27 reads, 47.1 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 130626297-130626363 [+]
intergenic
Database links

Mature sequence hsa-miR-6856-5p

Accession MIMAT0027612
Sequence

6 - 

aagagaggagcaguggugcugugg

 - 29

Get sequence
Deep sequencing14 reads, 11 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6856-3p

Accession MIMAT0027613
Sequence

46 - 

uacagcccugugaucuuuccag

 - 67

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).