Stem-loop sequence hsa-mir-6854

AccessionMI0022700 (change log)
Symbol HGNC:MIR6854
DescriptionHomo sapiens miR-6854 stem-loop
Stem-loop
   aaagcaa       uuu     c   u  u  c  c 
5'        gcucagg   gagaa ugc ga gu au a
          |||||||   ||||| ||| || || || g
3'        cgaguuc   cucuu gcg cu ca ua u
   -----ga       -uc     u   u  u  a  c 
Get sequence
Deep sequencing
46 reads, 0 reads per million, 32 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 98229149-98229217 [-]
sense
OTTHUMT00000406922 ; PTCH1-015; intron 13
OTTHUMT00000053229 ; PTCH1-001; intron 15
OTTHUMT00000053231 ; PTCH1-003; intron 15
OTTHUMT00000053230 ; PTCH1-002; intron 15
OTTHUMT00000406923 ; PTCH1-007; intron 15
ENST00000375290 ; PTCH1-015; intron 13
ENST00000331920 ; PTCH1-001; intron 15
ENST00000430669 ; PTCH1-003; intron 15
ENST00000429896 ; PTCH1-002; intron 15
ENST00000375274 ; PTCH1-007; intron 15
ENST00000437951 ; PTCH1-203; intron 15
ENST00000421141 ; PTCH1-202; intron 15
ENST00000418258 ; PTCH1-201; intron 15
Database links

Mature sequence hsa-miR-6854-5p

Accession MIMAT0027608
Sequence

6 - 

aagcucagguuugagaacugcuga

 - 29

Get sequence
Deep sequencing37 reads, 27 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6854-3p

Accession MIMAT0027609
Sequence

49 - 

ugcguuucuccucuugagcag

 - 69

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).