Stem-loop sequence hsa-mir-6853

AccessionMI0022699 (change log)
Symbol HGNC:MIR6853
DescriptionHomo sapiens miR-6853 stem-loop
Stem-loop
   gggaaa   ug  aug    -    gu     ga   uga 
5'       gcg  gg   ucca ugaa  caggu  ugg   u
         |||  ||   |||| ||||  |||||  |||    
3'       cgc  cc   aggu acuu  guccg  acu   a
   ----ga   gu  -ca    u    --     ga   gga 
Get sequence
Deep sequencing
55 reads, 0 reads per million, 19 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 35732922-35732995 [+]
sense
OTTHUMT00000052349 ; CREB3-001; 3'UTR (exon 2)
OTTHUMT00000052350 ; CREB3-002; exon 2
ENST00000353704 ; CREB3-001; 3'UTR (exon 2)
ENST00000486056 ; CREB3-002; exon 2
Database links

Mature sequence hsa-miR-6853-5p

Accession MIMAT0027606
Sequence

6 - 

agcgugggauguccaugaagucag

 - 29

Get sequence
Deep sequencing5 reads, 2 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6853-3p

Accession MIMAT0027607
Sequence

53 - 

uguucauuggaacccugcgcag

 - 74

Get sequence
Deep sequencing44 reads, 13 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).