Stem-loop sequence hsa-mir-6852

AccessionMI0022698 (change log)
Symbol HGNC:MIR6852
DescriptionHomo sapiens miR-6852 stem-loop
Literature search

1 open access papers mention hsa-mir-6852
(1 sentences)

Stem-loop
   ugcu  -       uu u        g ucuga 
5'     gc ccugggg  c gaggacau c     c
       || |||||||  | |||||||| |      
3'     cg ggacucc  g cuccugua g     u
   gggu  u       uu u        - ucccc 
Get sequence
Deep sequencing
747 reads, 0 reads per million, 94 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 35710676-35710741 [-]
sense
OTTHUMT00000052353 ; TLN1-001; exon 33
ENST00000314888 ; TLN1-001; exon 33
ENST00000540444 ; TLN1-201; exon 33
Database links

Mature sequence hsa-miR-6852-5p

Accession MIMAT0027604
Sequence

6 - 

cccugggguucugaggacaug

 - 26

Get sequence
Deep sequencing243 reads, 63 experiments
Evidence experimental; meta-analysis [1], Illumina [2]
Predicted targets

Mature sequence hsa-miR-6852-3p

Accession MIMAT0027605
Sequence

42 - 

uguccucuguuccucag

 - 58

Get sequence
Deep sequencing39 reads, 23 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).
2
PMID:23535375 "Interleukin-27 treated human macrophages induce the expression of novel microRNAs which may mediate anti-viral properties" Swaminathan S, Hu X, Zheng X, Kriga Y, Shetty J, Zhao Y, Stephens R, Tran B, Baseler MW, Yang J, Lempicki RA, Huang D, Lane HC, Imamichi T Biochem Biophys Res Commun. 434:228-234(2013).