Stem-loop sequence hsa-mir-6851

AccessionMI0022697 (change log)
Symbol HGNC:MIR6851
DescriptionHomo sapiens miR-6851 stem-loop
Stem-loop
   caggga     u     u         caaccuga 
5'       ggagg gguac aggggccag        u
         ||||| ||||| |||||||||         
3'       ccucc ccaug uucccgguu        u
   ----ga     -     u         ucucccca 
Get sequence
Deep sequencing
520 reads, 2.04 reads per million, 49 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 33467869-33467935 [-]
sense
OTTHUMT00000001015 ; NOL6-001; intron 6
OTTHUMT00000001020 ; NOL6-006; intron 11
OTTHUMT00000001018 ; NOL6-004; intron 11
OTTHUMT00000001019 ; NOL6-005; intron 11
ENST00000464829 ; NOL6-001; intron 6
ENST00000455041 ; NOL6-201; intron 10
ENST00000353159 ; NOL6-006; intron 11
ENST00000297990 ; NOL6-004; intron 11
ENST00000379471 ; NOL6-005; intron 11
Database links

Mature sequence hsa-miR-6851-5p

Accession MIMAT0027602
Sequence

6 - 

aggaggugguacuaggggccagc

 - 28

Get sequence
Deep sequencing104 reads, 35 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6851-3p

Accession MIMAT0027603
Sequence

47 - 

uggcccuuuguaccccuccag

 - 67

Get sequence
Deep sequencing37 reads, 18 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).