Stem-loop sequence hsa-mir-6850

AccessionMI0022696 (change log)
Symbol HGNC:MIR6850
DescriptionHomo sapiens miR-6850 stem-loop
Literature search

1 open access papers mention hsa-mir-6850
(5 sentences)

Stem-loop
   -----      aacg         g  ggagg 
5'      gugcgg    cuggccggg cg     g
        ||||||    ||||||||| ||     g
3'      cacgcc    ggccggccc gc     a
   gcacu      gcaa         -  aggga 
Get sequence
Deep sequencing
143 reads, 0 reads per million, 46 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 144791931-144791991 [-]
sense
OTTHUMT00000382203 ; RP11-429J17.4-001; intron 3
ENST00000527579 ; RP11-429J17.4-001; intron 3
antisense
OTTHUMT00000382200 ; ZNF707-029; intron 2
OTTHUMT00000382190 ; ZNF707-007; intron 3
ENST00000508587 ; ZNF707-029; intron 2
ENST00000527561 ; ZNF707-007; intron 3
Database links

Mature sequence hsa-miR-6850-5p

Accession MIMAT0027600
Sequence

1 - 

gugcggaacgcuggccggggcg

 - 22

Get sequence
Deep sequencing99 reads, 26 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6850-3p

Accession MIMAT0027601
Sequence

38 - 

cccggccggaacgccgcacu

 - 57

Get sequence
Deep sequencing12 reads, 10 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).