Stem-loop sequence hsa-mir-6849

AccessionMI0022695 (change log)
Symbol HGNC:MIR6849
DescriptionHomo sapiens miR-6849 stem-loop
Literature search

1 open access papers mention hsa-mir-6849
(2 sentences)

Stem-loop
   c    ga       g   ag  u    ag  a  a 
5'  cugg  guggaua ggg  ug gugg  ag gc c
    ||||  ||||||| |||  || ||||  || || u
3'  gacc  caccugu ucc  ac cacc  uc cg g
   -    uc       g   -g  -    cg  -  a 
Get sequence
Deep sequencing
21 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 144400277-144400345 [-]
sense
OTTHUMT00000381247 ; TOP1MT-001; intron 8
OTTHUMT00000381248 ; TOP1MT-002; intron 8
OTTHUMT00000381298 ; TOP1MT-007; intron 8
OTTHUMT00000381299 ; TOP1MT-006; intron 8
OTTHUMT00000381294 ; TOP1MT-003; intron 9
OTTHUMT00000381295 ; TOP1MT-005; intron 9
ENST00000329245 ; TOP1MT-001; intron 8
ENST00000519148 ; TOP1MT-002; intron 8
ENST00000518951 ; TOP1MT-007; intron 8
ENST00000519139 ; TOP1MT-006; intron 8
ENST00000521193 ; TOP1MT-003; intron 9
ENST00000523676 ; TOP1MT-005; intron 9
Clustered miRNAs
< 10kb from hsa-mir-6849
hsa-mir-6849chr8: 144400277-144400345 [-]
hsa-mir-1234chr8: 144400086-144400165 [-]
hsa-mir-939chr8: 144394149-144394230 [-]
Database links

Mature sequence hsa-miR-6849-5p

Accession MIMAT0027598
Sequence

6 - 

gaguggauaggggagugugugga

 - 28

Get sequence
Deep sequencing9 reads, 7 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6849-3p

Accession MIMAT0027599
Sequence

48 - 

accagccuguguccaccuccag

 - 69

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).